| http://www.w3.org/ns/prov#value | - y of the consensus receptor sequence for binding to MetR. The nucleotide sequence can be, for example: GTTAATGTTGAACAAATCTCATGTTGCGTG (SEQ ID NO: 11) [0086] A sample, such as plasma, blood or urine, is treated to release any protein bound homocysteine prior to admixing the sample with a reagent solution comprising MetR in a buffering agent in the presence of the immobilized consensus receptor sequ
|
